FastQCFastQC Report
Tue 15 Mar 2016
40-FW17B3Muscle_131121_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename40-FW17B3Muscle_131121_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9172067
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TCCACGTATTTCATGACCGTCGTAACTGCCGCCCCGCTACGGGGCGGGCT94740.10329187521198875No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCGCCG29000.051.24260394
CCACGTA32550.041.308892
CACGTAT34700.040.8023573
GCCCCGT8800.032.38061
CGTTAGG21200.031.3065035
CGCTACG27850.031.02429434-35
CCCGCTA28250.030.93513532-33
ACTGGCC28150.030.13596594
ACGTATT48850.029.8037414
GTTTGCG47500.029.4806378
TACGGGG28250.029.41066238-39
CTACGGG29300.029.30834636-37
GCTACGG29100.028.65329436-37
TCCACGT47250.028.6456951
ATACGCC16500.028.0961177
CGCCCGC27300.028.06624492-93
GGGGCGC26600.027.16630276-77
AAGCGCC29550.027.05401266-67
CGTATTT69050.026.5132085
GGGACTA23900.026.31019238-39