FastQCFastQC Report
Tue 15 Mar 2016
40-FW17B3Muscle_131121_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename40-FW17B3Muscle_131121_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences9172067
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG1103891.2035346013063357No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT159450.1738430388700824No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC143050.15596266359589392No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC136180.148472530782865No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG128920.14055719392368154No Hit
CAGCCACAAGCACGTCCCCTAGAGTTTCAGCTAGTGAACAAACGCGATGT93520.10196174973427473No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT124150.095.4989494
TTCAGCC148400.073.263551
CAGCCAT164000.066.790343
ATGGCCT164750.066.0003368
AGCCATG166500.065.8417364
CATGGCC170200.063.85767
CCATGGC171700.063.1671526
TCAGCCA173950.062.840072
GCCATGG183350.059.7179035
TGGCCTG183350.059.2582139
GGCGGTC129300.045.81973392-93
GGGCGGT130700.045.28666792-93
ATGGGCG128800.044.3601590-91
TGGGCGG130000.043.88951590-91
ATCGCGG124700.043.80307464-65
GCGCGCA135000.042.1698484-85
CGCGCAT134600.041.9170284-85
CCGCGCG136900.041.14229682-83
GCATGGG138300.040.88778388-89
CGCGGCT134550.040.714766-67