FastQCFastQC Report
Tue 15 Mar 2016
40-FW17B3Muscle_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename40-FW17B3Muscle_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences110958
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG11711.0553542781953533No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA2000.18024838227076911No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT1800.1622235440436922No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGG1390.12527262567818453No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCC1240.11175399700787685No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC1130.10184033598298456No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTT1120.10093909407163071No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT800.0188.0302994
GTCCGTC254.888915E-4102.3505284-85
ATGGGCG750.093.0334790-91
GGCGGTC800.091.8287592-93
CCGTCTC308.2135265E-489.8190686-87
GACCCGG259.516615E-486.581476-77
GGGCGGT950.077.32947592-93
CATGGGC950.074.9798688-89
TGGGCGG950.073.4474790-91
GGTCTCC400.00212471970.6898788-89
GGCCGCG1350.070.0017680-81
CGCGCAT1300.069.56711684-85
GCATGGG1050.067.8389288-89
AAGGCCG1550.065.9402878-79
GCGCGCA1450.065.3405484-85
AGGCCGC1450.065.2665578-79
TTCAGCC4500.064.1285861
GCGGCTG1550.060.60392468-69
CCGCGCG1500.060.43608582-83
AGCCATG4850.060.1926234