FastQCFastQC Report
Tue 15 Mar 2016
4-Wingbud8A1_131203_L002_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename4-Wingbud8A1_131203_L002_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences23217896
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG377400.16254702837845428No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GAGCGCG46700.022.4994939
TGAGCGC48750.022.0148358
CAGGAGG191450.021.6226923
ACCCTAT104000.021.209214-15
CGGGGGT46650.020.78268
TGCGGGG48100.020.7173926
GCAGGAG206400.020.2853492
GAGGTGA199500.020.1404199
AGGAGGT199950.019.8681017
ACCAGGC123300.019.57395678-79
CCGGGGA38500.019.3247494
ATGCGGG51150.019.3051955
GTGACCC104750.018.6218712-13
GACCCTA104100.018.58896814-15
CTCTACC121550.018.58583322-23
GCCGGGG42500.018.4621723
CGCAACG39800.018.3643741
GTCATCC123600.018.35599750-51
GGGGGTA57550.018.3359839
GGAGGTG223950.018.1622058