FastQCFastQC Report
Tue 15 Mar 2016
39-FW17B3Head_131121_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename39-FW17B3Head_131121_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences33665646
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT1093860.32491876139848913No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT434760.12914054879564765No Hit
AACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT337630.10028917906402272No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC133800.041.922653
TGACCTA142900.039.358315
CTGACCT153850.036.572854
GCCTAAC70350.035.4576952
ATAATCG135300.032.08963494
CCCGCCG79200.031.61772794
GCCCCGT37200.031.120131
GACCTAA184950.030.396616
CCCCCGA40400.029.4121021
GGCCGTT92850.029.1707971
ACCTGAC204350.025.674792
GTCGCGT88800.025.428784-85
AACGCGC41300.025.4122837
CTAGCTC88000.025.12901594
GTACCTA128550.024.7992177
ATACGCC50050.024.6392547
CGGTACC90600.024.1657125
ATAAGCG84850.023.65122882-83
CCCCGAT42600.023.2784882
ACTCGGT78000.023.2667647