FastQCFastQC Report
Tue 15 Mar 2016
39-FW17B3Head_131121_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename39-FW17B3Head_131121_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences33665646
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT1041220.3092826437965872No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT989130.2938098974842188No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG821720.24408264733728857No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT405880.12056207090159504No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGCAAT130750.034.35524
CCGGGGA79450.030.8540614
ACCTCGG79250.029.3750617
GCCGGGG85550.028.9638373
ATGCCGC148500.028.107271
CGTACCA83700.028.0736891
CCTCGGA85600.027.3004638
GCGGTCT32900.026.30404994
TGCCGCA159750.026.1278822
CAGGAGG350950.025.1960283
CGGGGGT50850.025.0201368
CTCGGAG96700.024.9443979
GCCGCAA185300.024.8135323
AGGCCGG102850.024.3066671
GAGGTGA342100.023.8130329
CGCAATG188800.023.7461625
ATGGGCC172050.023.2637839
AGGAGGT346050.023.1944227
GCAGGAG381000.022.7102932
CGTCGGT71650.022.37915882-83