FastQCFastQC Report
Tue 15 Mar 2016
39-FW17B3Head_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename39-FW17B3Head_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences404513
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT5150.12731358448306976No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TACCCTG1856.039045E-1042.9288294
AATCGGA1159.9271056E-538.36633794
ACACGGA1600.037.479922
ATGGGCC1450.036.682049
CGCGGTT1102.728484E-1035.56802786-87
CGGACCA1400.035.3232465
AGACGGA1000.002315309835.2970394
CAGCTTA1501.1420305E-535.2970394
AACACGG1600.035.2752151
CGGTTGA1153.3833203E-1034.86281288-89
ACCATCG2201.3287718E-732.0882194
CGTCGGT702.5364116E-531.42855382-83
ATGCCGC1600.030.8658141
CCGCAAT1950.030.7527544
TCGGGAT550.005047729730.11412290-91
GTTGACC1401.9736035E-929.57637290-91
GGGGGTA604.6127295E-429.5494219
GCGCGGT1255.037873E-827.30512684-85
AAATCGG1300.00835755327.15156294
TGCCGCA1950.027.1347832