FastQCFastQC Report
Tue 15 Mar 2016
38-Normal8A3Ovary_131121_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename38-Normal8A3Ovary_131121_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences24262153
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA480200.197921429314208No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG395240.16290392695157763No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG264260.10891861080918912No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG123900.046.09770294
CGACCGA82100.043.8282136
ACGACCG85500.041.878735
GGCCAGG111950.040.8581594
CGGACCA117900.039.8003855
ACCGAGC93150.038.5380868
CCGAGCG94250.038.229389
GACCGAG98150.036.796517
AACACGG129050.036.563541
GACGACC99100.036.3507734
ACACGGA142400.033.443092
CATGACG113600.033.020981
CGGATCG68750.030.02010386-87
ATCGGGC72750.029.65729390-91
CGCGGTT120000.029.2660786-87
AGCCGGG115100.029.06684974-75
CGGTTGA127050.028.34736488-89
GGACCAA166900.028.1166466
GTCTAAC119050.026.88599216-17
GTTGACC138650.026.69434290-91