FastQCFastQC Report
Tue 15 Mar 2016
38-Normal8A3Ovary_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename38-Normal8A3Ovary_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences254284
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA24480.9627031193468719No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG3820.15022573185886648No Hit
TAACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTA3640.14314703245190416No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG2600.0119.5330394
AATCGGA801.1719203E-768.555794
CGGTTGA2950.062.31432788-89
GTTGACC3150.060.01913590-91
TGACCAT3300.059.9607892-93
GGGGTGC553.863479E-757.732760-61
CGCGGTT3200.056.72522786-87
GACCGAG1050.056.3617177
CGACCGA1050.056.3173146
GCGGCGC3450.052.12211682-83
ACCGAGC1150.051.5318078
GTCGGAA550.00850235449.85869694
ACGACCG1200.049.2388535
GGGCGCG3700.049.19601478-79
AGCCGGG3900.047.53351274-75
GACCATC3250.047.04615492-93
CGGACCA5500.046.1318055
CGGATCG356.232813E-446.10050286-87
GGTTGAC3100.045.82204488-89
AACACGG5550.045.0544851