FastQCFastQC Report
Tue 15 Mar 2016
37-Normal8A3Muscle_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename37-Normal8A3Muscle_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences414784
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG20660.4980905724425243No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA8750.2109531708069742No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC5070.12223229439901251No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT4710.11355307822866842No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT2350.0113.2048894
TTCAGCC7350.058.096041
TCAGCCA8100.052.7167782
ATGGGCG2300.052.44512690-91
ATGGCCT8200.051.4123578
CCATGGC8500.049.513926
TGGCCTG8550.049.385449
AGCCATG8700.049.0811354
CAGCCAT8650.048.9602133
CATGGCC8650.048.714147
GCCATGG9000.047.101635
CGCGCAT2450.046.6052684-85
ATCGCGG3250.045.69632364-65
CGGTTGA1150.045.6591588-89
TGGGCGG2650.045.51841490-91
TCGCGGC3300.045.44885366-67
GCGCGCA2600.045.3803784-85
CGCGGCT3250.045.260666-67
ACCATCG2002.5465852E-1144.33857794
GGGCGGT3000.043.586492-93