FastQCFastQC Report
Tue 15 Mar 2016
36-Normal8A3Head_131121_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename36-Normal8A3Head_131121_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20029845
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT466800.233052227813046No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC70800.038.184373
TGACCTA76650.035.3397755
CTGACCT78900.034.5948224
GCCTAAC39400.033.7561262
ATAATCG94850.033.72203494
CCCGCCG56650.029.97053394
GCCCCGT22100.029.1069581
GACCTAA95750.028.6184336
GTCGCGT62950.027.71598284-85
AACGCGC32300.027.614737
GGCCGTT62450.025.7511521
CTACGGG35450.025.1377836-37
ATAAGCG59250.025.12131382-83
TACGGGG36050.024.72726238-39
GTACCTA101500.024.6914127
GCTACGG36600.024.28736536-37
CCCCGAT23200.024.1673552
CCCCGTA22150.024.1356372
CCCCCGA29600.023.7876031
ACTCGGT57050.023.6426147