FastQCFastQC Report
Tue 15 Mar 2016
36-Normal8A3Head_131121_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename36-Normal8A3Head_131121_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20029845
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG522260.2607409093779807No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT514870.25705141502592754No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT439320.2193327007772651No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT297520.1485383436566783No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGCAAT91750.033.5355224
CCGGGGA53300.031.3378754
ATGCCGC106550.027.4335081
GCCGGGG61150.026.9555343
ATGGGCC106050.026.9459089
CAGGAGG203100.026.2953833
GAGGTGA193000.025.7857199
TGCCGCA112600.025.6862452
AGGAGGT192800.025.2627477
ACCTCGG59100.024.768787
CGTACCA60300.024.3468231
GCCGCAA130700.024.2141953
AGGCCGG71750.023.9534451
GCAGGAG218000.023.53032
CCTCGGA62200.023.2526728
CGCAATG135050.023.0768595
CGATCAG74500.022.8922564
GGAGGTG218950.022.8890238
TGCAGGA227500.022.5477181
AATGGGC127500.022.4804388