FastQCFastQC Report
Tue 15 Mar 2016
36-Normal8A3Head_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename36-Normal8A3Head_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences227204
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA3730.16416964490061794No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT3180.13996232460696115No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG2590.11399447192831114No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGTCTA207.5969285E-570.5819556
AGCACGG150.002171581670.4110953
ACGGTCT200.00673291252.913125
ATGCGGG404.375875E-544.094275
ACACGTT1152.9013027E-643.0674490-91
ACGTTGT1108.1517086E-539.6485692-93
AGACACG1256.259981E-638.50929388-89
CACAACG654.6298192E-737.9136621
ATGGGCC1500.037.760339
TGCCGCA1400.037.7202262
ATGCCGC1500.037.552581
CCGCAAT1550.036.341214
CGATTGT400.002309192435.3221477
CCAGCCG400.00234697235.2055471
CGATGCG652.0143449E-532.4974252
AATGGGC1750.032.3445248
ACACGGA1108.440111E-1032.0050432
CCCGCCT552.8851285E-432.0050432
TCGGTCT603.023863E-431.74843284-85
TGCGGGG450.00413044931.369766