FastQCFastQC Report
Tue 15 Mar 2016
34-Normal21A2Muscle_131121_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename34-Normal21A2Muscle_131121_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18133920
Sequences flagged as poor quality0
Sequence length10-100
%GC36

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[FAIL]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CGAGAACAAAAAATAAATTAATAATTTTTAATAAACCCTGATACAAAAGG947260.5223691292340542No Hit
CTACTTAATCATTAGCTACACCTTGACCTGACATAACATAAAATAATATA697600.3846934363888227No Hit
ACCTCATCAATAAATTGAAATATATAAGAATAATCATACAATATCTACAA588570.32456854337065566No Hit
CTCTCATATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG556490.3068779392431421No Hit
CACCCCAACCAAATACAATACATTAAAAATAATTAAATACAATCTAAACA556080.3066518436168242No Hit
GCAGGTGGGAGATTTTGATATCATTCTAAAGAACTATTTAAGTTTATAGA536940.2960970380370047No Hit
GCACCTAATAATTTTCTTAATCCAACATCGAGGTCGCAATCTTTATTATC490310.27038279643893876No Hit
CCAACCAAATACAATACATTAAAAATAATTAAATACAATCTAAACAAAAA435130.2399536338530224No Hit
ACCTCGTCAATAAATTGAAATATATAAGAATAATCATACAATATCTACAA399260.22017302381393544No Hit
CTCTCGTATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG395250.21796169829799622No Hit
CGAGAGCAAAAAATAAATTAATAATTTTTAATAAACCCTGATACAAAAGG381210.21021930172847347No Hit
TCATCTTTATTCCATAATATAGGTTCAATTAACCAATCATCATAGTTAAA376610.20768261909173527No Hit
CATAGTTTATGTATTATGGGATTAATTAAAAAATATATAAAGTATATGAT360300.1986884247862569No Hit
ACCCCAACCAAATACAATACATTAAAAATAATTAAATACAATCTAAACAA343830.18960599804123984No Hit
CCCCAACCAAATACAATACATTAAAAATAATTAAATACAATCTAAACAAA301210.16610308195911308No Hit
GAACTCAGATCATGTAAGAATTTAATGGTCGAACAGACCAATAAATTAAG295230.1628053945313534No Hit
ACCTCTTTCTTGTCTAATAATATGAGAAATTATTCCAAAGCCTGGTAAAA280100.1544619144674731No Hit
CGAGGACAAAAAATAAATTAATAATTTTTAATAAACCCTGATACAAAAGG272860.15046939657834602No Hit
CTACTCAATCATTAGCTACACCTTGACCTGACATAACATAAAATAATATA267650.1475963277658664No Hit
ATGGATTCATCTAGAAGATATAATAGTCGTAATGAAGGTAAAGCAATAAA252830.1394237980535924No Hit
CCCCAGCCAAATACAATACATTAAAAATAATTAAATACAATCTAAACAAA247450.13645698227410288No Hit
CTACCTAATCATTAGCTACACCTTGACCTGACATAACATAAAATAATATA221930.12238390816767693No Hit
TACCTCTTTCTTGTCTAATAATATGAGAAATTATTCCAAAGCCTGGTAAA217420.11989685627817924No Hit
TCGAGAACAAAAAATAAATTAATAATTTTTAATAAACCCTGATACAAAAG210700.11619109381755297No Hit
CGTGTAATATCACGTCATCATTGAATTATGGTTAATAATGTAATTATAAA199280.10989350344547677No Hit
ACATCCATACCAACAGTAAATATATGATGTGCTCATACAACAAATCCTAA194950.10750571305046014No Hit
CTCCACAAGATAATCTTACTGACGGCGGTATATAAGCTGATAACAAAATT194760.10740093702850789No Hit
CCACCAAAATTAATAATAAAATACATGAAAATAATAATAACAATTAACTT191650.10568591898497401No Hit
CCCCCAATTATAATTGGTATTACTATGAAAAAGATTATGACAAATGCATG182950.10088828008505608No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG183700.077.984594
ACCTCGT71100.062.7874571
CCCCCGA43350.060.7345121
GCCCCGT32850.059.020091
AGGTGGG93500.058.3766863
CGAGAGC63650.057.192551
GTGGGAG101700.056.596095
GGTGGGA103750.055.457924
GGTATAG32800.053.79613594
CGTCAAT98050.053.632095
GGGAGAT118400.053.4134187
GCCCCGA28550.052.8531721
CCCCGAC67350.052.255532
CACATTT537450.052.0748594
ATCTAGA99850.051.6069689
CGTATAA81600.050.995265
ACCCCGA39000.050.975991
CGTGCTC69000.050.8921294
CTCTCGT83700.050.714271
CAGGTGG108600.050.0124662