FastQCFastQC Report
Tue 15 Mar 2016
34-Normal21A2Muscle_131121_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename34-Normal21A2Muscle_131121_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18133920
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[FAIL]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG3007961.6587478052180664No Hit
GCCCAATGAGGTTTTTAATGGCCGCGGTATATTGACCGTGCAAAGGTAGC902050.4974379505368944No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC784860.4328132031022526No Hit
ACCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATTATATA768240.42364805844516795No Hit
AAGGCTGGAATGAATGGTTTGACGAAATAATTACTGTCTCGTGATGATGA630200.34752552123313657No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC604560.33338627279705657No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG535020.29503824876254003No Hit
AGTGATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAATAT530770.29269457458729276No Hit
TACAGTGATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAA466650.2573354244421504No Hit
ACAGTGATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAAT462800.25521233136574994No Hit
AGCTGGTATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCAT390940.21558493695792197No Hit
GGAATGAATGGTTTGACGAAATAATTACTGTCTCGTGATGATGACTTGAA349130.19252869760095997No Hit
AGCAGGAATCTCTTCCATTTTAGGAGCTGTCAATTTTATTACAACCATAA298510.16461415954189718No Hit
AATCACCATTTCGGGTTTGAAGCAGCAGCATGATACTGACACTTTGTAGA287190.15837171444453266No Hit
GGAATAGTAGGTACATCTTTAAGTATTTTAATTCGAACAGAATTAGGACA274340.15128554664407917No Hit
CAGTGATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAATA271260.1495870721829588No Hit
AAAAGGTGAAGTAGTAGTAATTAGTTTTATACAATAAAATTGTTTTTGAT243470.1342622003405772No Hit
ACCTTAGGGATAACAGCGTAATGTTATTGGAGAGTTCTTATTGATAATAA242640.13380449456047008No Hit
ATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCATGAAATAT238980.13178617750602187No Hit
ATACCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATTATA237880.13117957948419315No Hit
TATATACCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATT236680.13051783618765275No Hit
GATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAATATAAT231850.1278543194190776No Hit
GTATTTGGTTGGGGTGACAAGGGAATATAATAACTTCTTATTATTTAACT215310.11873329098176236No Hit
AGCCCATGACCCATTACAGGTGCTATTGGAGCTATAACAATAGCAGCAGG215010.11856785515762726No Hit
CCTGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTT210710.11619660834502413No Hit
GGGGTGACAAGGGAATATAATAACTTCTTATTATTTAACTATGATGATTG208140.11477937478493344No Hit
GGCCGCGGTATATTGACCGTGCAAAGGTAGCATAATCATTAGTCTTTTAA200030.11030709300581451No Hit
CCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATTATATAT185380.10222831026055039No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TGCAGGA502400.056.435881
CAGGAGG541400.053.0720023
GCAGGAG546850.052.022192
GTGAGCC64850.051.35461494
AGGAGGT556150.050.773817
GAGGTGA560300.050.7712069
GGAGGTG563250.050.2878388
AATTTCT703150.049.2481994
GCGGTCT24150.042.78932694
GGAGGAG698750.041.6913955
AGGAGGA686600.041.5850944
GAGGAGG702900.040.725586
GCCCAAT226000.040.4520761
CCCAATG241450.038.0883262
CAGCTTA184050.037.53220494
CGCAACG37500.037.497061
TAGCCCA52700.036.891471
TGAGGTT259600.035.3756567
CCAATGA265700.034.9183653
ACCAGGC516150.034.88023478-79