FastQCFastQC Report
Tue 15 Mar 2016
34-Normal21A2Muscle_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename34-Normal21A2Muscle_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences210623
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG14630.6946060021934927No Hit
GCCCAATGAGGTTTTTAATGGCCGCGGTATATTGACCGTGCAAAGGTAGC5080.24118923384435698No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC4090.19418582016209057No Hit
AGCAGGAATCTCTTCCATTTTAGGAGCTGTCAATTTTATTACAACCATAA2920.1386363312648666No Hit
ACCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATTATATA2880.1367372034393205No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC2870.13626242148293397No Hit
AGCTGGTATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCAT2460.11679636127108625No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG2350.11157375975083443No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA2260.10730072214335566No Hit
AAGGCTGGAATGAATGGTTTGACGAAATAATTACTGTCTCGTGATGATGA2120.10065377475394426No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTGAGCC308.750272E-6109.0424294
GTTCGAC659.094947E-1265.570752-53
CCCGGTT403.5081255E-545.7741243
AATTTCT4000.044.97999694
CGATTTC708.516663E-443.2470290-91
CCGGTTA350.001003428641.850634
ACCCGTC350.001003428641.850634
ACCGGTG456.431538E-541.3059488-89
GGACGAG800.001121584740.89090394
ACCCGGT457.029512E-540.6881142
ATGGCCT851.5988917E-938.884168
TCAGACC459.265545E-538.8260884-85
GTTGGAT1150.038.220525
CCATGGC902.8412614E-936.6628236
CCCGTCC400.001932040236.6285
AACCCGT400.001934294736.61933
ATCCCCC400.001934294736.61932
AGACCGG501.4267815E-436.07964786-87
TTCGACC603.7125574E-935.68729852-53
GCCATGG1152.3646862E-1135.0354775