FastQCFastQC Report
Tue 15 Mar 2016
33-Normal21A2Head_131121_L008_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename33-Normal21A2Head_131121_L008_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences27009996
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT618540.22900410647968997No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG140350.041.13069594
CCCGCCG97350.039.49083394
CCTGACC84150.038.6825263
GCCTAAC51850.033.8566862
TGACCTA101950.031.8532315
CTGACCT104900.031.2833444
CCCCGAT33950.031.1803952
CCACGTA99150.031.0952872
CCCCCGA40650.031.0323621
GCCCCGT32150.031.0053621
AGGTGGG75700.030.9976143
ATCTAGA115250.030.6325829
CACGTAT106000.030.2927063
CTACGGG70400.029.33074836-37
TACGGGG69050.029.19291138-39
CATCTAG124500.028.0630158
ACCTCGT62700.027.8571681
GCTACGG72600.027.85390936-37
TCCACGT115050.027.4879191
CGCTACG75300.027.4849134-35