FastQCFastQC Report
Tue 15 Mar 2016
33-Normal21A2Head_131121_L008_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename33-Normal21A2Head_131121_L008_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences27009996
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG1264310.4680896657667036No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT685450.2537764167014316No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT664120.24587934037457837No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC429710.15909295210558344No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT407650.15092560546843473No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG400810.14839320968429615No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC358300.13265459202585592No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGACCGA88000.043.931436
ACGACCG91400.042.442025
GACCGAG99000.039.321747
CCGGGGA114950.039.0277864
CCGCAAT118300.038.4886174
ACCGAGC103400.037.5633748
GCCGGGG121950.036.860783
CAGGAGG347450.036.2175983
CCGAGCG108650.035.8316769
GGCCAGG131550.035.2268494
GAGGTGA348350.035.1168149
AGGAGGT345450.034.969877
TGCAGGA366750.033.9830321
CGCAACG88300.033.7195661
AGGCCGG137600.033.674081
GCAGGAG373750.033.5973782
CGTACCA77050.033.2549361
CAGCTTA132700.033.23598594
ACCTCGG76950.032.8946957
GGAGGTG371250.032.7331288