FastQCFastQC Report
Tue 15 Mar 2016
33-Normal21A2Head_131121_L008_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename33-Normal21A2Head_131121_L008_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences346580
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA11520.3323907900051936No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG6810.19649143054994517No Hit
ATGCCGCAATGGGCCCCTGCTCTCGACTTGACTGCCAACGCGACGCTGGT5000.14426683593975417No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC4810.13878469617404351No Hit
CATGACGACCGAGCGTCCGCATCAAGCCTATCATCAATATGGTCACCCTG4560.1315713543770558No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATCGGGC858.54925E-1173.5417490-91
AAATCGG1401.8189894E-1259.77530794
ACCATCG2300.054.57745494
CCCGTGT200.00641383353.572681
CCGTAGA403.345326E-452.3011860-61
GACGGAA653.6062027E-451.49872694
CGGTTGA2150.047.99537788-89
ACCGAGC1500.045.3897748
ACGACCG1500.045.2914285
GGCCAGG1559.6915755E-943.19248294
GTTGACC2400.042.76350890-91
CGCGGTT2350.042.74904686-87
CCGCAAT2050.041.8128244
GACCGAG1650.041.2335857
CGACCGA1650.041.2037856
CGCAACG701.6076228E-840.817281
TGACCAT2650.040.5528392-93
GACGACC1700.039.9168974
CGGGCCA1651.9574145E-839.88704392-93
ATGGGCC2000.039.4459889