FastQCFastQC Report
Tue 15 Mar 2016
32-Normal6A3Ovary_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename32-Normal6A3Ovary_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20720037
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG345400.16669854402287024No Hit
GGCGTCCGTCTCGTCCTCGGCACGGGCCACGGACCGCGGGTTCGGTTTCA274780.13261559330227066No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGGGGA48200.029.3092634
GGCGTCC91950.029.2609941
GCCGGGG48300.029.2489323
CGTCCGT95150.028.6036423
GTCCGTC95300.028.2741154
CGTCTCG97700.027.5356227
GCGTCCG99400.027.204142
CCGTCTC99700.027.1182256
TAGCCCC21950.024.4741171
TCCGTCT111000.024.1943025
ACCGCCG51150.024.094151
GGCCGGG62950.023.3067762
AGGCCGG70350.022.395251
CCGCCGT68150.021.5284162
CCGTCAG71000.021.1692265
GTCATCC123700.021.11330450-51
CAGGAGG203600.020.660983
ACCAGGC135350.020.6594878-79
ACCCTAT128400.020.43040314-15
CTCTACC129700.019.8696822-23