FastQCFastQC Report
Tue 15 Mar 2016
32-Normal6A3Ovary_131203_L005_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename32-Normal6A3Ovary_131203_L005_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences231824
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC2850.12293809096556008No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGGGGA1200.044.5135574
GCCGGGG1350.039.5676043
AGGCCGG1600.035.792991
CCGTCTC1500.035.6647076
CGGGGAA1500.035.6185265
CGTCCGT1550.034.462113
CCGTGTG450.002815776533.922415
GTCCGTC1600.033.3851664
GCGTCCG1650.032.3944632
GGCGTCC1750.030.543351
GTAAGGC500.00472195330.5235824
GGCCGGG1900.030.1414662
CGTCTCG1651.8189894E-1230.1326147
CCGCTCG901.8189894E-1228.48079120-21
AAATCGG1000.006760845428.35206294
TCCGTCT1900.028.1198945
CCGCGGG853.43789E-1027.81810234-35
CCCCTGG550.00749877327.7666822
GCCCTGG707.3664344E-427.270851
CGTTCGG756.932951E-726.58713758-59