FastQCFastQC Report
Tue 15 Mar 2016
31-Normal6A3Muscle_131203_L005_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename31-Normal6A3Muscle_131203_L005_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17431719
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TCCACGTATTTCATGACCGTCGTAACTGCCGCCCCGCTACGGGGCGGGCT261340.14992210464154454No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCACGTA77850.045.707062
CACGTAT87800.042.641743
CCCGCCG113750.039.87885394
ATAATCG85800.037.60547694
TCCACGT100950.035.4670261
GTACCTA191400.034.2797627
ACGTATT116850.033.7050554
ACCTAAG199350.032.9586459
TCCGGTA30700.031.6759993
CGAGGGG62150.031.3323948
TACGGGG78050.031.049938-39
CGCTACG80250.031.0471834-35
CTACGGG80650.030.8738836-37
CCCGCTA81600.030.75063932-33
AGGTGGG43950.030.675173
CGGTACC142050.030.192995
GGGGCGC71550.030.17969976-77
CCCCCGA29400.030.0696741
AAGCGCC77800.029.8865366-67
GCTACGG81000.029.87807336-37