FastQCFastQC Report
Tue 15 Mar 2016
31-Normal6A3Muscle_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename31-Normal6A3Muscle_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17431719
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG711310.40805499446153304No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC572930.3286709704303976No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC305210.17508887104019977No Hit
GGCGTCCGTCTCGTCCTCGGCACGGGCCACGGACCGCGGGTTCGGTTTCA296800.17026433250788406No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG191850.11005799255942572No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA191670.10995473251949506No Hit
GGACCGTGAAGCGACAATATTTCTCAGGAGTCCCCGAGTCGAACAAGGCT177370.10175129601389284No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGGGGA140850.041.816094
GCCGGGG141550.041.609543
GCAGAGC172600.040.12149494
CGGGGAA161950.036.479225
GGCCGGG177450.034.284552
GCGGTCT36600.034.19027794
AGGCCGG176000.034.184911
GGACCGT56450.033.1976171
CAGCTTA106550.032.84176394
CAGGAGG226500.032.2967873
CGGACCA62750.031.5732785
TGCAGGA223800.031.5711751
AGGAGGT219850.031.5635247
GAGGTGA221750.031.5581429
AACACGG69850.030.4874971
GCAGGAG238750.030.0637072
GGAGGTG235150.029.7972498
ACACGGA74100.028.3758742
CCGCAAT59300.027.967394
GGTGACC164300.026.87823510-11