FastQCFastQC Report
Tue 15 Mar 2016
31-Normal6A3Muscle_131203_L005_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename31-Normal6A3Muscle_131203_L005_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences194341
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC9740.5011809139605127No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA3830.1970762731487437No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG2710.13944561363788394No Hit
GGACCGTGAAGCGACAATATTTCTCAGGAGTCCCCGAGTCGAACAAGGCT2580.13275634065894484No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG1600.066.1584594
GCAGAGC1950.065.916194
ACACGGA1350.048.382912
GTCCGCC403.589849E-545.5936368
AACCCGT502.7035894E-643.544623
AACACGG1450.042.5435941
CGCGGTT1550.039.94045686-87
CGGACCA1650.039.626815
CGGTTGA1600.039.48195688-89
GTCGGTC1700.038.77897682-83
GTTGACC1600.038.13317590-91
GCCGGGG4150.037.598773
CCGGGGA4200.037.1511654
CGGTCTC1850.036.4527584-85
TCGGTCT1850.036.4527584-85
GGACCAA1800.036.3714186
CGGGGAA4300.036.3245745
CGTCGGT1850.035.6347482-83
CGCTATC1800.035.18263274-75
GCGCGGT1350.034.9676484-85