FastQCFastQC Report
Tue 15 Mar 2016
30-Normal6A3Head_131203_L005_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename30-Normal6A3Head_131203_L005_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20851634
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT616850.2958281350996282No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT289940.13904905486064065No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC84550.044.9689753
CTGACCT95450.040.387594
GCCTAAC57200.038.203352
TGACCTA101500.037.9911845
CCCGCCG71600.030.79275794
GACCTAA131400.029.657836
ATAATCG88200.028.79522794
CCCCCGA31350.028.247131
AACGCGC29050.028.2358197
CACGTAT68950.027.7952613
CCACGTA66800.027.5027032
GTACCTA130750.027.0499387
CTACGGG43800.026.98057236-37
TACGGGG43950.026.58464438-39
GCTACGG44650.026.26605836-37
ACGGGGC45250.025.92019838-39
CGGTACC94450.025.2427165
CCCCGTA25200.025.1754782
CGCTACG47600.024.87303734-35
ACCTAAG143650.024.6698069