FastQCFastQC Report
Tue 15 Mar 2016
30-Normal6A3Head_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename30-Normal6A3Head_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20851634
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT723240.34685051540804906No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT667960.3203394036170019No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG442470.2121991974345991No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC229720.11016882417943842No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCGGGGA69200.033.196484
GCCGGGG72600.031.9492593
CGGACCA57850.026.1395245
AGGCCGG88600.026.1350571
GGCCGGG92400.025.5430982
AACACGG63200.025.4847261
CGACCGA43950.025.0699796
CCGCAAT74750.023.8096284
ACGACCG48450.023.753485
CGGGGAA96800.023.7319375
CAGGAGG209550.023.4578383
ACACGGA69950.023.3444272
ATGCCGC67750.023.0488171
CGTCGGT66150.022.75898682-83
GAGGTGA204050.022.081629
AGGAGGT201650.022.055777
CGCTATC69700.021.06270674-75
GGTGACC138450.020.96172510-11
TCCCGCA78450.020.9314590-91
GCAGAGC131550.020.90681394