FastQCFastQC Report
Tue 15 Mar 2016
30-Normal6A3Head_131203_L005_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename30-Normal6A3Head_131203_L005_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences204564
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC3980.19456013765863006No Hit
AACACGGACCAAGGAGTCTAACATGTGCGCGAGTCAATGGGAGCTTCTAA2820.13785416788877808No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG904.3718384E-544.0666194
GCAGAGC2001.8189894E-1243.62594694
CGACCGA457.79506E-539.9799656
GGACCAA851.9517756E-938.0985536
TCCCGCA1101.0913936E-1137.5287990-91
CGCTATC1100.036.27635274-75
CCCGCAG1251.8189894E-1236.02763790-91
AACACGG1002.4920155E-1035.8588031
GCTATCT1250.034.3788274-75
ATGCCGC1054.2018655E-1034.151241
CGGACCA955.9408194E-933.996435
GTCGGTC1201.8189894E-1233.7232782-83
CGGGGAA2600.033.124735
TCGTCGG1300.032.759180-81
CTCACGG450.003733022132.023258
AGGCCGG2700.031.8744931
CCGGGGA2700.031.86674
GCCGGGG2700.031.86673
AGCTTCG1300.030.94518768-69
GGTCTCC1401.0913936E-1130.36490486-87