FastQCFastQC Report
Tue 15 Mar 2016
3-Wingbud21B_131203_L002_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename3-Wingbud21B_131203_L002_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences33357915
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG346350.10382843172302586No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGGGGGT36550.018.617078
GGTGTGC202950.016.9147827
ACCAGGC162000.016.0780478-79
CAGGAGG265250.015.8542313
ACCCTAT144950.015.57539914-15
CTACCGC54300.015.55970594
CCGGGGA47600.014.846814
GTCATCC156850.014.83882950-51
GTGTGCT317150.014.7833718
GCAGGAG281800.014.7437712
GAGGTGA257350.014.722489
CAGGCTT180750.014.685739580-81
GAGTACG86950.014.6427539
GCCGGGG48050.014.5257583
GACCCTA129550.014.08730314-15
TGTGCTC231200.014.0330139
CTCTACC164750.013.76170522-23
GGTGACC170200.013.7112310-11
AGGAGGT282200.013.4401917
CCAGGCT160250.013.39599880-81