FastQCFastQC Report
Tue 15 Mar 2016
29-FW23B1Testis_131203_L005_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename29-FW23B1Testis_131203_L005_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17526777
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT1505600.8590284454466444No Hit
AACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT633880.3616637559774966No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT497970.2841195503314728No Hit
CGCCCGGTACCTAAGTCGTCTACGGAAGATTCCGAGTCCCGACATCGTTG254530.14522350572498297No Hit
GACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT202630.11561167235710251No Hit
GGCTAGTTTTCTCATTTATTCCACTTAAGGTCTTCCAAAAAATTACTACG194880.11118986679638818No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC151000.062.2163733
TGACCTA172950.054.64395
ACCTGAC171850.050.755612
CTGACCT188850.049.8646284
AACCTGA144600.045.6637951
GTACCTA165150.044.2509547
CGGTACC119600.042.265075
GCCCGGT93200.041.132622
GACCTAA233000.041.126726
GCCTAAC66250.039.3159872
GTATCAA207700.038.7420794
GGTACCT146450.038.3284076
CCCGGTA108500.037.4662483
ACCTAAG197050.036.992899
GCACGTC67500.036.52527694
CCTTACC59750.035.7686463
CGCCCGG90650.035.216851
CTTACCT61450.034.851574
GGCTAGT59750.034.3528061
TTACGCG37650.034.103939