FastQCFastQC Report
Tue 15 Mar 2016
29-FW23B1Testis_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename29-FW23B1Testis_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17526777
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT1542290.8799621288044003No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT1193780.6811178119057485No Hit
TTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGG402920.22988824471264738No Hit
CTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAG313450.1788406390975363No Hit
GGCGTCCGTCTCGTCCTCGGCACGGGCCACGGACCGCGGGTTCGGTTTCA300980.1717258113114579No Hit
GATTCTACTAAAAATGAAAAATAATTTCAAGTTTTCAAGTATCAAGCCCT209350.119445805694909No Hit
GTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAG178390.10178140567430054No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTTAGGT116700.027.9977871
GGTGTGC98750.026.0299457
CACCGGT32000.025.420772
CGTCCGT124000.024.5694273
GTGTGCT126600.024.2445968
GTCCGTC129700.023.5587524
CTCAAGT165650.022.81091394
CGTCTCG135200.022.6684597
CCGTCTC136650.022.394466
TGTGCTC103400.022.166269
TCCGTCT142000.021.4869445
CCGGGGA40750.021.2820284
GCCGGGG42400.021.0898883
ACACCGG44300.019.3771441
ACCGGTG47950.019.0236783
GGCGTCC160000.019.0164221
TCTACTA108950.018.889554
ATCGGAT70700.018.8133225
TCGGATG75950.018.223266
AGGCCGG55550.018.122751