FastQCFastQC Report
Tue 15 Mar 2016
28-FW23B1Muscle_131203_L005_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename28-FW23B1Muscle_131203_L005_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15689092
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CATAGTTTATGTATTATGGGATTAATTAAAAAATATATAAAGTATATGAT311750.1987049346131695No Hit
GCAGGTGGGAGATTTTGATATCATTCTAAAGAACTATTTAAGTTTATAGA281810.1796216122641132No Hit
CTCTCATATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG276930.17651117094603053No Hit
CTCTCGTATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG222280.14167805249660081No Hit
CGAGAACAAAAAATAAATTAATAATTTTTAATAAACCCTGATACAAAAGG213180.13587784430099586No Hit
ACCTCATCAATAAATTGAAATATATAAGAATAATCATACAATATCTACAA171300.10918413889089312No Hit
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT158780.10120407223056631No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG134800.063.5379494
CCCCCGA25900.050.6025961
AGGTGGG63450.047.403193
GCCCCGT17350.046.603921
CGTGCTC72550.045.7382994
GGTGGGA79450.043.057364
CCCCGAT28200.040.8038562
CTCTCGT55550.040.548471
ATCTAGA87550.040.503259
GTGGGAG85400.040.2800565
GGGAGAT94250.039.6328747
CTCGTCA55950.037.8764153
CATCTAG95750.036.652068
ACCTCGT44900.036.1157881
GGAGATT104850.035.7193768
CGTCAAT60950.035.365115
CAGGTGG83550.034.8825262
CGTATAA68400.034.372145
TGGGAGA103950.034.084526
GTTTATG137450.033.627585