FastQCFastQC Report
Tue 15 Mar 2016
28-FW23B1Muscle_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename28-FW23B1Muscle_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences15689092
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG1037160.6610707617751238No Hit
CGCAACGATGATTATTTTCTACTAATCATAAAGACATTGGAACTTTATAT389900.24851661268861192No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC301170.1919613958538837No Hit
AGCTGGTATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCAT293140.18684319016039933No Hit
GGAATAGTAGGTACATCTTTAAGTATTTTAATTCGAACAGAATTAGGACA260240.16587320668398145No Hit
CAACATTTTTTAGGTCTAGCTGGTATACCACGACGGTACTCCGATTATCC240430.1532465996120107No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG235880.1503464955142082No Hit
ACAGTGATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAAT199180.12695444707698827No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT188470.12012804820062245No Hit
AATCACCATTTCGGGTTTGAAGCAGCAGCATGATACTGACACTTTGTAGA182810.11652044618005936No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT170840.10889094155353286No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAACG77950.059.0173761
CGATGAT105650.044.134086
CAACGAT107250.043.4741443
GCAACGA109900.042.718372
AACGATG115750.040.2423364
CAGGAGG261400.038.904683
TGCAGGA265250.037.769871
CAGCTTA93250.036.5607894
AGGAGGT278050.035.8986787
GCAGGAG282250.035.765572
GAGGTGA281200.035.7544179
GGAGGTG292750.034.281538
ACGATGA146850.032.0873575
GCGGTCT16700.029.69443994
GGTGACC215550.028.39855610-11
CTCTACC216550.028.31440222-23
ACCAGGC238950.028.27817378-79
AATTTCT444800.027.83390894
GGAGGAG381600.027.109285
CCTATTC226350.027.09655616-17