FastQCFastQC Report
Tue 15 Mar 2016
27-FW23B1Head_131203_L005_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename27-FW23B1Head_131203_L005_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences17324645
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT722740.4171744933301663No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT296390.1710799846115173No Hit
AACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT259420.1497404420119431No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC91150.050.1234663
CTGACCT101250.045.476374
TGACCTA101750.045.2671435
GCCTAAC47500.037.138612
ATAATCG85100.036.61848494
GACCTAA131200.035.4254266
CCCGCCG36550.033.9444294
CCCCCGA21750.032.6482621
ACCTGAC129450.032.1885762
GCCCCGT17750.029.4380951
CCCCGTA20450.028.6088332
AGGTGGG47300.028.5146473
GGGCCGT16200.027.292441
CCCCGAT21600.026.4653972
GGTGGGA60350.025.9747894
CGGTACC45850.025.0410545
GGCCCCT22950.024.7140081
ACGGGGC30000.024.61134738-39
CACGTAT49500.024.5406383
GCTACGG30150.024.52274336-37