FastQCFastQC Report
Tue 15 Mar 2016
27-FW23B1Head_131203_L005_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename27-FW23B1Head_131203_L005_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences195061
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC3900.19993745546265013No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG2520.1291903558374047No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ACCATCG604.3483617E-449.56521694
TAGCCCA456.325603E-541.4208761
CCGGGGA2000.039.1226654
GCCGGGG2000.039.1226653
AGGCCGG2300.037.278791
TCCCGCA708.771585E-734.93990390-91
CGGGGAA2400.034.1985365
GGCCGGG2400.034.1722262
TGCGTCG350.003702203732.0807870-71
CGTCGGT901.1146767E-831.87499882-83
GTCGGTC801.4131547E-731.87499882-83
GCAGAGC1402.29154E-531.86335494
CCCATGA603.4444738E-431.049734
CGCTATC1051.2187229E-1030.39349774-75
GGACCGT753.619394E-529.8230321
CTGAGCG500.00530093929.8077434
GAAACTC2650.029.6786949
ACCACCG655.5045635E-428.6612873
CGGTTGA605.6053506E-428.57395788-89
CATCCTA400.006572359228.52796772-73