FastQCFastQC Report
Tue 15 Mar 2016
26-FW17B2Testis_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename26-FW17B2Testis_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences28215093
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGCCATCGGATGAAACATGTGTAGATATCAGTTGTTCTAATGGAATACGA417060.1478145048113079No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT348490.12351190903393443No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT345010.1222785266027654No Hit
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC316140.11204641430740633No Hit
ACCAAGATGTGTTGCGGTGGGTGCTGCGGTAGCTGCTGCGGCTGCTGTTG312560.11077758985235313No Hit
GATTCTACTAAAAATGAAAAATAATTTCAAGTTTTCAAGTATCAAGCCCT292400.10363247783730502No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CACCGGT60850.040.1634452
CCGGGGA100900.030.3271274
ACCGGTG87450.028.657433
GCCGGGG109700.027.894473
ACACCGG88200.027.8611031
AGGCCGG116550.027.1026251
ATCGGAT153150.026.6609545
CCGGTGA96400.025.9039884
TCGGATG163800.025.1193946
GCTCCCC128100.024.9686894
CCATCGG180550.023.603973
CTGATTC225600.022.84285794
GCAGAGC158600.022.81712594
CGGATGA189200.022.432377
GGCCGGG143100.022.2614842
TGGGTCG117350.022.24993594
AGATGTG351200.021.7641645
CATCGGA197050.021.4913544
TCGGTCT93800.021.37874884-85
CCCCAGG150950.021.2803738