FastQCFastQC Report
Tue 15 Mar 2016
26-FW17B2Testis_131203_L005_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename26-FW17B2Testis_131203_L005_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences268510
Sequences flagged as poor quality0
Sequence length10-100
%GC44

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AGGCCGGGGAAACTCATCACCGCTCGCGTGCACGCTCGAGCTACCCGACC5530.2059513612155972No Hit
GCTGCCAGTGCTGTTGCGTACCTTGCTGTATTTGTTGTTGCTGCCCATGC3280.12215559941901606No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCAGAGC1655.456968E-1250.44658394
AGGCCGG3550.032.0943151
GGCCGGG3750.031.3033052
CCGGGGA3650.031.2092064
GCCGGGG3650.031.2092063
TCGGTCT1451.0913936E-1130.0859884-85
CGGGGAA3850.029.6155245
CGGTCTC1402.5283953E-1028.56377284-85
CTATCTC1950.028.56191476-77
GCTATCT1700.028.30255174-75
TTGGGGC500.007543774327.7342077
GGTCTCC1504.0563464E-1027.41768886-87
GTCTCCC1654.1836756E-1127.19109586-87
CCGCCAA1100.00847224427.07097486-87
CGCAGAG1705.857146E-1026.55985892-93
CGCGGTT858.3337385E-526.39135786-87
TCGTCGG1705.456968E-1226.21160980-81
TCCCGCA1656.91216E-1026.1875490-91
CGCTATC1850.026.0077574-75
GAAACTC4150.026.0033879