FastQCFastQC Report
Tue 15 Mar 2016
25-FW17B2Muscle_131203_L005_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename25-FW17B2Muscle_131203_L005_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20167484
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CGAGAACAAAAAATAAATTAATAATTTTTAATAAACCCTGATACAAAAGG298120.14782210810232946No Hit
GCAGGTGGGAGATTTTGATATCATTCTAAAGAACTATTTAAGTTTATAGA274990.1363531514392177No Hit
CTACTTAATCATTAGCTACACCTTGACCTGACATAACATAAAATAATATA253450.1256725925752563No Hit
CATAGTTTATGTATTATGGGATTAATTAAAAAATATATAAAGTATATGAT240690.11934557627515659No Hit
CTCTCATATAATGAAGATTAATATAATAATCCCGATTAAGGAAATAGTTG203960.10113309126711097No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
ATAATCG130050.055.7141794
CCCCCGA29150.044.0635071
AGGTGGG75050.040.012773
ATCTAGA107300.038.5297629
CCCCGAT26550.036.867812
GCCCCGT18800.036.5168651
GGTGGGA91150.036.3952524
ACTGGCC59250.034.10851794
CATCTAG121600.033.8056568
CCCCGAC30350.033.7110982
GGGAGAT116350.033.4916347
GTGGGAG100400.032.9196365
GGTGTGC78950.032.7829866
CGTGCTC65250.031.97414494
GGTACGT47550.031.7631441
GGAGATT123750.031.4266138
CGTTAGG52850.031.3528145
ACGCTTA51150.031.201167
CTAGATA77550.031.1643378
CAGACGC45450.030.8919284