FastQCFastQC Report
Tue 15 Mar 2016
25-FW17B2Muscle_131203_L005_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename25-FW17B2Muscle_131203_L005_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20167484
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG1162750.5765468811082235No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC816110.40466624393999767No Hit
CGATGTTGGATTAAGAAAATTATTAGGTGCAGAAGCTTAATTTATTGGTC552860.27413434417500965No Hit
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG439170.21776142229739714No Hit
GCCCAATGAGGTTTTTAATGGCCGCGGTATATTGACCGTGCAAAGGTAGC393560.19514580995824765No Hit
AGCTGGTATACCACGACGGTACTCCGATTATCCAGACGCTTATACTTCAT337250.16722462752418696No Hit
CGAATTGGAAAGAGTTATTTGTTTATGATTTATATTGTTGTATAAATATA299120.14831795577475107No Hit
ACAGTGATGGAAATGTGAAAGAATTGAAAATATTATTTTTGAGGAGAAAT298610.14806507346181605No Hit
ACCTTAGGGATAACAGCGTAATGTTATTGGAGAGTTCTTATTGATAATAA272210.13497469490988565No Hit
GGAATAGTAGGTACATCTTTAAGTATTTTAATTCGAACAGAATTAGGACA266490.13213844622363405No Hit
ACCGCCGTCAGTAAGATTATCTTGTGGAGAGTATAAAATTTCATTATATA259010.12842950563392044No Hit
CGCAACGATGATTATTTTCTACTAATCATAAAGACATTGGAACTTTATAT235380.11671262513459785No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG203740.1010240047791782No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GCGGTCT79250.064.9029394
CAGCTTA218150.045.5756494
CGCAACG72300.042.4084851
GTGAGCC85300.042.20973294
CAGGAGG286850.040.2802283
CATGGCC109500.040.1560557
ATGGCCT113700.038.3975268
CCATGGC116600.038.017466
GAGGTGA297650.037.769159
TATCTAG97850.037.6047294
GCAGGAG307400.037.506112
TGCAGGA304650.037.3002471
AGGAGGT300800.036.9398277
TTCAGCC121150.036.4828221
GAAACCC219300.036.1800882
GGAGGTG316550.035.4848948
ATCGCGG65450.035.07930464-65
TCGCGGC69600.032.82893866-67
AGCCATG136750.032.5778054
TGGCCTG137600.032.1524629