FastQCFastQC Report
Tue 15 Mar 2016
25-FW17B2Muscle_131203_L005_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename25-FW17B2Muscle_131203_L005_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences201817
Sequences flagged as poor quality0
Sequence length10-100
%GC42

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTCAGCCATGGCCTGCACGCGCTTCATCTGGGTTTTCGCCGCCGTGGCCG6460.32009196450249483No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG3670.18184791172200557No Hit
TGAAACCCAAAGAATTTGGCGGTGTTTTAGTCCTTTCAGAGGAATCTGTC2470.1223881040744833No Hit

[OK]Adapter Content

Adapter graph

[WARN]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GTCGGAA300.001420582178.3234894
GCGGTCT701.3544195E-767.13441594
ATGGGCG352.1240521E-762.9605190-91
GAGTACG306.373297E-661.0591559
AATCGGA552.1875212E-456.96253294
TTCAGCC2350.054.293051
CAATCGG450.007082753352.21565694
GCTAGAA603.3619773E-452.21565294
GTTACCC200.00762375551.27521584-85
CATGGCC2450.047.707857
TCAGCCA2450.047.6132622
AGCCATG2500.046.6609954
CAGCTTA1201.0614167E-745.68869894
ATGGCCT2550.044.4708068
CAGCCAT2700.043.2046243
CGATGAT601.8710853E-742.5506446
CCATGGC2700.041.875246
CGGCTGT900.040.61661568-69
TCGCGGC950.040.60817366-67
GCATCGC1050.040.4291962-63