FastQCFastQC Report
Tue 15 Mar 2016
24-FW17B2Head_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename24-FW17B2Head_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18981007
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT495380.26098720684313537No Hit
GACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT228180.12021490745986238No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT198970.10482583985138406No Hit
AACCTGACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT190330.10027392118869141No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCTGACC78900.040.0498773
CTGACCT88300.035.9832574
TGACCTA89000.035.4704445
GGTGTGC82000.034.1098376
GCCTAAC48000.033.1423762
ATAATCG77800.032.36481594
CCCCCGA30200.029.7925171
GACCTAA108300.029.5217086
CCCGCCG33150.029.05364694
GCCCCGT21400.029.0446451
GTGTGCT122900.028.7528847
CCCCGAT22200.026.8232522
GTGCTCT131150.026.1675429
GGGCCGT17200.025.5232941
CCCCGTA22650.025.3308352
TGTGCTC146350.023.738148
CCCCGTT39100.022.4552782
GGCCCCT22500.022.2156561
GTCCCGT32100.022.2066291
AAACCCG48800.021.7128376-77