FastQCFastQC Report
Tue 15 Mar 2016
24-FW17B2Head_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename24-FW17B2Head_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18981007
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT534940.2818290936829642No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT533770.28121268803072463No Hit
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG494830.2606974435023389No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CAGGAGG193200.026.9708353
GAGGTGA207600.024.131599
GCAGGAG211500.023.8750322
AGGAGGT206400.023.7365197
TGCAGGA220750.023.2133431
ACCAGGC144750.023.1697978-79
GGAGGTG224750.022.1911038
GCCGGGG33600.021.8554823
CAGCTTA99650.021.78503694
GCGGTCT18100.021.77646494
GTCATCC139500.021.76604750-51
CGCTAGG20450.021.7184855
CAGGCTT155650.021.62427380-81
GGTGACC137650.021.39476210-11
CCGGGGA36150.021.0436464
CGCAACG37250.021.0187151
CTCTACC143350.020.54172922-23
GTGACCC126300.019.9951212-13
TGACCCT146400.019.95457512-13
ACGCTAG22400.019.8269774