FastQCFastQC Report
Tue 15 Mar 2016
23-FW11B3Testis_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename23-FW11B3Testis_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18827916
Sequences flagged as poor quality0
Sequence length10-100
%GC39

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT317220.1684838619420227No Hit
TGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAG281150.1493261389099038No Hit
CATAGTTTATGTATTATGGGATTAATTAAAAAATATATAAAGTATATGAT192390.10218337494176202No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTGAGAG178700.078.09064594
GCCCCGT23000.043.2774621
ATAATCG88150.042.69202894
TCGGTCC247600.036.36242388-89
CCTGAGA196400.035.77123692-93
GTAGCAA346350.035.359289
AGTCGGT252250.035.23194586-87
TAGTAGC349550.035.0179527
GTCCTGA242650.034.94529790-91
GTCGGTC250050.034.83543486-87
TCAGTCG259150.034.19457284-85
CGGTCCT265800.033.09019588-89
CAGTCGG263400.032.7900984-85
AGGGGCG69050.032.4275257
AGTAGCA382850.032.214588
GGTCCTG286750.031.86175390-91
GGGTCAG267250.031.6118280-81
GGTCAGT276750.031.55073282-83
CATGGGT273150.031.39842478-79
CTACTGA97850.030.80619494