FastQCFastQC Report
Tue 15 Mar 2016
23-FW11B3Testis_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename23-FW11B3Testis_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences18827916
Sequences flagged as poor quality0
Sequence length10-100
%GC40

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG728920.3871485298744694No Hit
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT486000.2581273466484554No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT387720.2059282609928789No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC284950.15134441857505632No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG237770.1262858831535046No Hit
GCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTGG218080.11582800773064846No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT194560.10333591885580964No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAACG52300.040.932811
GCGGTCT29850.035.9604694
GAACCCG112600.032.372311
CAGGAGG255450.030.3954983
GACTCCC122950.029.6789727
CCCGACT123450.029.627874
TGCAGGA262650.028.7223821
CCGACTC129800.028.1107715
AGGAGGT265300.027.8777267
GCAGGAG286050.026.8395542
ACTCCCT135150.026.836438
AACCCGA139600.026.493772
GGACCGA174000.026.1613395
CTCCCTT137700.026.146529
GAGGTGA288350.025.9600379
ACCGACT179300.025.3897787
GACCGAC180000.025.3152266
GGAGGTG299650.025.1435078
CGACTCC145950.025.0013856
GCAACGA89050.024.8399472