FastQCFastQC Report
Tue 15 Mar 2016
22-FW11B3Muscle_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename22-FW11B3Muscle_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16913615
Sequences flagged as poor quality0
Sequence length10-100
%GC41

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT210590.12450916022387881No Hit
TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT199610.11801734874537465No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTGAGAG130500.067.2913694
GGTGTGC136950.037.91246
CGGTCCT173750.033.70269488-89
GCACGTC60600.033.30286494
GTGTGCT221550.033.191057
TCGGTCC174550.032.620488-89
TGTGCTC225250.032.5853088
AGTCGGT175850.031.96874486-87
CAGTCGG176050.031.75514684-85
GGGTGTG91150.031.705115
TAGTAGC242600.031.689717
CCTGAGA140250.031.43450792-93
TGGGGGT56350.031.1743161
GGGTCAG179050.030.95192580-81
GTCGGTC181400.030.91401386-87
TCAGTCG184050.030.8791384-85
CCTGACC47150.030.4496363
GGTCCTG188250.030.37507290-91
GTCCTGA180850.030.27354690-91
GGTCAGT183650.029.98597182-83