FastQCFastQC Report
Tue 15 Mar 2016
22-FW11B3Muscle_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename22-FW11B3Muscle_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences16913615
Sequences flagged as poor quality0
Sequence length10-100
%GC43

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT308070.1821432023845878No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT278530.1646779827966996No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT248790.14709451527659817No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT209820.12405390568485802No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG173040.10230811095085232No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC172560.10202431591354065No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
GGTCCTC43250.037.7881243
AGGTCCT56550.029.141042
GACTCCC99300.028.2320147
GTCCTCC60900.026.6921144
CCCGACT111600.025.5099334
ACTCCCT110350.025.3663568
AACCCGA112750.025.3339652
CTCCCTT114450.024.7277249
ATCGGAT63750.023.91515
GAGGTCC89600.023.6398871
GGACCGA126500.023.5831685
CGACTCC120700.023.4070076
TCGGATG67850.022.6652436
AGGACCG131350.022.5438634
CGACTGA134550.022.046229
GACCGAC136400.021.8080336
GGTGTGC125650.021.7519577
CGCACCG34200.021.5868642
ACCGACT137400.021.4588387
AGATGTG178050.021.4190715