FastQCFastQC Report
Tue 15 Mar 2016
21-FW11B3Head_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename21-FW11B3Head_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20390600
Sequences flagged as poor quality0
Sequence length10-100
%GC37

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[FAIL]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[WARN]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCTAACCT330230.16195207595656821No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CCCCCGA24550.040.688481
ATAATCG98650.038.3228794
CCCCGAT25250.036.4096452
CCCGCCG30650.036.3939294
GCCCCGT20900.035.9515081
CCTGACC57950.029.3644473
ACCTCGT48100.029.1292081
AGGTGGG59650.028.8980563
CCCCGTA21800.028.7903122
AAACCCG89150.028.15802276-77
GGTGGGA70000.027.9717864
GTGGGAG72250.026.988335
GCCTAAC37300.026.8987142
CGTGCTC60250.025.6194994
ATAAGCG68000.025.5856982-83
CCCCCGT34900.025.075771
AAGCGTC76350.024.9148484-85
TAAGCGT69500.024.66095782-83
AACCCGA99650.024.51292476-77
CCCCGTT43950.024.4377882