FastQCFastQC Report
Tue 15 Mar 2016
21-FW11B3Head_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename21-FW11B3Head_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences20390600
Sequences flagged as poor quality0
Sequence length10-100
%GC38

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGCAGGAGGAGGTGACCCTATTCTCTACCAACATTTATTTTGATTCTTTG880160.4316498778849077No Hit
CGCAACGATGATTATTTTCTACTAATCATAAAGACATTGGAACTTTATAT375210.18401126009043384No Hit
AGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTT330170.16192265063313488No Hit
TAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGTTAGGT311100.15257030200190283No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CGCAACG88250.052.3360181
GCGGTCT23300.042.74669694
CAACGAT120000.039.4829643
GCAACGA121650.039.142862
CGATGAT123800.037.838726
AACGATG131250.035.792214
CAGGAGG259400.033.2561843
GAGGTGA274350.030.861249
GCAGGAG286350.029.8542232
AGGAGGT279850.029.6620037
TGCAGGA286700.029.5994471
GGAGGTG301600.028.0423438
ACGATGA175350.027.0458135
CCGGGGA36700.027.0378424
CTCTACC193150.025.29970422-23
CGGGGGT19450.025.2811938
ACCAGGC214300.025.160978-79
GGTGACC192950.025.06957210-11
GCCGGGG38650.024.748533
CAGCTTA98350.024.45896594