FastQCFastQC Report
Tue 15 Mar 2016
20-Normal8A2Testis_131203_L004_R2.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename20-Normal8A2Testis_131203_L004_R2.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22753029
Sequences flagged as poor quality0
Sequence length10-100
%GC45

[OK]Per base sequence quality

Per base quality graph

[WARN]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
TGGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAG643100.28264368669331896No Hit
GCCCAGTGCTCTGAATGTCAAAGTGAAGAAATTCAATGAAGCGCGGGTAA537210.23610482806487No Hit
TTTGGGTTTTAAGCAGGAGGTGTCAGAAAAGTTACCACAGGGATAACTGG515930.22675222714303223No Hit
GGGGCGGTACACCTGTCAAACGGTAACGCAGGTGTCCTAAGGCGAGCTCA447070.19648812472396532No Hit
TGATTTTCAGTACGAATACAGACCGTGAAAGCGGGGCCTCACGATCCTTC415490.18260865399503512No Hit
TGGTGTTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAG371300.16318706401683925No Hit
GGTGGTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAGA341870.15025252242239923No Hit
TGGTGATAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAG312680.1374234612894837No Hit
GTCTGGTTAATTCCGATAACGAACGAGACTCTGGCATGCTAACTAGTTAC312120.13717734021259323No Hit
TGGTGCTAGTAGCAAATATTCAAACGAGAACTTTGAAGGCCGAAGTGGAG228070.10023720358287241No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTGAGAG386950.0108.9761694
CCGTTAA66600.062.37747694
CTACTGA237000.057.35083894
ATACCGG101000.050.3283659
CCTACTG361700.050.0065194
CCTGAGA460000.045.96851392-93
GTCCTGA558100.045.4932690-91
GTGCTAG54600.045.475183
GCCCCGT31350.044.550441
AATACCG115850.044.0023278
GGTGCTA57750.043.5030982
GTACACC146750.043.3658147
CGCGATA18800.043.2801973
TCGGTCC643200.041.64353688-89
GGTGTTA108850.040.727892
AGTCGGT653000.040.49678486-87
GGTCCTG686600.039.8962190-91
TCAGTCG664750.039.82069884-85
CGGTCCT671150.039.4489488-89
CAGTCGG656150.039.37389884-85