FastQCFastQC Report
Tue 15 Mar 2016
20-Normal8A2Testis_131203_L004_R1.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename20-Normal8A2Testis_131203_L004_R1.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences22753029
Sequences flagged as poor quality0
Sequence length10-100
%GC46

[OK]Per base sequence quality

Per base quality graph

[FAIL]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[WARN]Per base sequence content

Per base sequence content

[OK]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[FAIL]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT1689560.7425648690554563No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC1483040.6517989319136367No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT1306280.5741125720008532No Hit
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG1268960.5577103602337957No Hit
CGGGTGGCTGAACGCCACTTGTCCCTCTAAGAAGTTGGGGGACGCCGACC624590.274508506098243No Hit
GATAAATGCACGCATCCCCCCCGCGAAGGGGGTCAGCGCCCGTCGGCATG549480.24149751666030927No Hit
GGCAACAACACATCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTC533640.23453580619969325No Hit
CGCCCCATTGGCTCCTCAGCCAAGCACATACACCAAATGTCTGAACCTGC498100.21891590785560905No Hit
GCCAGAGTCTCGTTCGTTATCGGAATTAACCAGACAAATCGCTCCACCAA457620.2011248700118125No Hit
GCTTACCAAAAGTGGCCCACTAGGCACTCGCATTCCACGCCCGGCTCCAC425710.1871003636482861No Hit
AGCCCTTAGAGCCAATCCTTATCCCGAAGTTACGGATCCGGCTTGCCGAC410560.180441909514553No Hit
AAGGGCATCACAGACCTGTTATTGCTCAATCTCGGGTGGCTGAACGCCAC408090.17935633976469684No Hit
CAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCACGT402140.17674130332273563No Hit
TGGTAGTAGTAGCAAATACTCTAGCGAGACCCTGGAGGGCTGATGTGGAG375580.16506813224735925No Hit
CATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAACCCAGCTCA374920.1647780609781669No Hit
CGTACTGAGCAGGATTACCATGGCAACAACACATCATCAGTAGGGTAAAA363620.15981168924805572No Hit
CCGCCACTCCGGATTCGGGGATCTGAACCCGACTCCCTTTCGATCGGCCG363000.15953919805578415No Hit
AAGAAGTTGGGGGACGCCGACCGCTCGGGGGTCGCGTAACTAGTTAGCAT356000.15646268459465332No Hit
GTATTCGTACTGAAAATCAAGATCAAGCGAGCTTTTGCCCTTCTGCTCCA341070.1499009208839843No Hit
GCTACGTACGAAACCCCGACCCAGAAGCAGGTCGTCTACGAATGGTTTAG334490.1470089982305213No Hit
CCCCGGGGCTCCCGCCGGCTTCTCCGGGATCGGTCGCGTTACCGCACTGG332980.1463453503267631No Hit
CACAGACCTGTTATTGCTCAATCTCGGGTGGCTGAACGCCACTTGTCCCT326990.14371273380788113No Hit
GCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCGCC316820.13924299925078107No Hit
CAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCTCC298200.13105947344417307No Hit
ACAACACATCATCAGTAGGGTAAAACTAACCTGTCTCACGACGGTCTAAA258860.11376946779261786No Hit
TGGCTACCTTAAGAGAGTCATAGTTACTCCCGCCGTTTACCCGCGCTTCA246810.10847346962024264No Hit
TTACTCACAATTTCAATAATTAACCATGATACCACTAACAAAGTGGGTAT238170.10467617300536118No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
CTAAGCC88950.055.35015594
CACCAAG132700.050.2346194
GCTCGTG99250.043.19661794
CGTCAGG81200.040.8093074
GACTCCC315700.039.059147
CTCCCTT321800.038.2837569
ACTCCCT323200.038.1021778
GGTCCTC33200.036.46933
CCCGACT342500.036.0210724
CGACTCC342700.035.8931356
AACCCGA343450.035.8707052
ACGTCAG93400.035.4787523
GCTTACC112300.034.814751
CACGTCA95950.034.7237242
ATGCACG180100.034.491386
GCACGTC96600.034.182131
CATGTTC521300.033.92632794
TACTCAC62750.033.861912
ACCCGAC366800.033.704223
AGTAGCA148000.033.3344468