FastQCFastQC Report
Tue 15 Mar 2016
20-Normal8A2Testis_131203_L004_R0.fastq.gz

Summary

[OK]Basic Statistics

MeasureValue
Filename20-Normal8A2Testis_131203_L004_R0.fastq.gz
File typeConventional base calls
EncodingSanger / Illumina 1.9
Total Sequences301025
Sequences flagged as poor quality0
Sequence length10-100
%GC49

[OK]Per base sequence quality

Per base quality graph

[OK]Per tile sequence quality

Per base quality graph

[OK]Per sequence quality scores

Per Sequence quality graph

[OK]Per base sequence content

Per base sequence content

[WARN]Per sequence GC content

Per sequence GC content graph

[OK]Per base N content

N content graph

[WARN]Sequence Length Distribution

Sequence length distribution

[OK]Sequence Duplication Levels

Duplication level graph

[WARN]Overrepresented sequences

SequenceCountPercentagePossible Source
AAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCCAACGCTTGGTG10930.36309276638152976No Hit
CTCAGGACCGACTGACCCATGTTCAACTGCTGTTCACATGGAAGCCTTCT8530.28336516900589653No Hit
CACGACGGTCTAAACCCAGCTCACGTTCCCTATTAGTGGGTGAACAATCC7590.2521385267004402No Hit
GAACCCGACTCCCTTTCGATCGGCCGAGGGCAACGGAGGCCATCGCCCGT7120.23652520554771198No Hit
GCCAGAGTCTCGTTCGTTATCGGAATTAACCAGACAAATCGCTCCACCAA4850.16111618636325886No Hit
GTATTCGTACTGAAAATCAAGATCAAGCGAGCTTTTGCCCTTCTGCTCCA4370.1451706668881322No Hit
CGGGTGGCTGAACGCCACTTGTCCCTCTAAGAAGTTGGGGGACGCCGACC4160.1381945021177643No Hit
CGCCCCATTGGCTCCTCAGCCAAGCACATACACCAAATGTCTGAACCTGC3990.13254713063699028No Hit
GCACGTCAGGACCGCTACGGACCTCCACCAGAGTTTCCTCTGGCTTCGCC3740.12424217257702849No Hit
AAGGGCATCACAGACCTGTTATTGCTCAATCTCGGGTGGCTGAACGCCAC3570.11859480109625448No Hit

[OK]Adapter Content

Adapter graph

[FAIL]Kmer Content

Kmer graph

SequenceCountPValueObs/Exp MaxMax Obs/Exp Position
TCCTCGG607.821709E-786.8491294
GTGCGCT400.001962604272.1984190-91
AGCATCC608.1856866E-569.479394
CTACCGC450.002284804669.47929494
AACGTCG801.6780723E-765.1002484-85
GCTCGTG500.00346911362.53136494
GGTCCTG601.9153958E-856.83300890-91
TGCGCCC250.006034060454.39769786-87
CTGAGAG1001.622459E-552.1094794
AAGACGT353.5045872E-451.80733586-87
GCGATGA850.051.39386474-75
TGGCTGG1251.033326E-650.02509394
GTCGGTC551.1259363E-649.45245486-87
TCGGTCC708.841016E-846.80775588-89
TGGGTCA705.180482E-946.38616680-81
AGTCGGT701.13781425E-745.33141786-87
GTCAGTC756.897608E-944.90596482-83
GAACGTC756.897608E-944.90596482-83
CGATGAC806.6029315E-1042.55890376-77
CATGGCT1803.2942262E-739.55136592-93